EST details — SGN-E521747

Search information 
Request: 521747Match: SGN-E521747
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C319955Clone name: Petunia-DevA-18-F08
nocartOrdering Not Available
Library Name: Petunia-DevAOrganism: Petunia hybrida

Tissue: all floral organs
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C319955 [Petunia-DevA-18-F08] Trace: SGN-T330563 EST: SGN-E521843 Direction: 5' Facility: U Fla ICBR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E521747Length: 448 bp (741 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E521747 [] (trimmed) CTTACCTAACAAAATCAATCAACCATGTCTTCCAAGCAAGGTGGAAAGGCCAAGCCTTTGAAGGCACCAAAGACTGAAAAGAAGGAATACGATGA
TAATGACAAGGCTTTTCTTCAAAAGAAGAAGGAAGAGGAAAAGGCACTAAAGGAGCTCAAGGCAAAGGCTCAGAAGGGTTCCATTGGTGGTGCTG
GCCTGAAAAAGAGTGGAAAGAAATGAGAATCTTATATTATCAGAGATATTAAAGAATTCTTCCTGTTAGTAGTGCAAGGCTCTTTTCTTGCCCAT
GGCTAGATTTGGTGTTCTAAGATCTTACTGTTAAGTTTCCGTAACTTTGGGATATTTCCGTGGTCACTGAATGGTTCGGTATGGTGCATTCGCTC
CTTTAAATGCATGTATCGTGATGCCTTAGCCTATCAGTAAACAAAAAAAAAAAAAAACAAAACAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E521747] SGN-U207554 Petunia hybrida Build 1 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T329603 [Download] [View] Facility Assigned ID: Petunia-DevA-18-F08.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0141 Quality Trim Threshold: 12.5