EST details — SGN-E526118

Search information 
Request: 526118Match: SGN-E526118
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C326055Clone name: Petunia-C2H4-5-C10
nocartOrdering Not Available
Library Name: Petunia-C2H4Organism: Petunia hybrida

Tissue: all floral organs
Development Stage: anthesis

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E526118Length: 404 bp (457 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E526118 [] (trimmed) CTTCCTCCTGTTCTGCATGGTATATCCTTCACAATTCCTCCAAGTGACAAAGTCGGAGTAGTTGGCAGGACTGGAGCTGGAAAATCTAGCATGTT
TAATGCTTTGTTCCGACTTGTGGAACTCGAAAGAGGGAGGATCTTAATTGATGATTATGATGTTTCAAAGTTTGGGCTGACAGATCTGCGTAAGG
TTCTTGGTATTATACCGCAGGCGCCAGTTTTGTTCTCAGGGACTGTGAGATTTAACCTTGATCCGTTCAATGAGCACAATGATGCTGACCTCTGG
GAGTCTTTAGAACGGGCACATCTAAAGGAAGTTATAAGAAGGAACTCTTTGGGTCTCGATGCTGAGGTCTCGGAAGCCGGAGAAAATTTCAGTGT
TGGACAAAGACAGCTTTTAAGTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E526118] SGN-U209563 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T333505 [Download] [View] Facility Assigned ID: Petunia-C2H4-5-C10.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0023 Quality Trim Threshold: 14.5