EST details — SGN-E526992

Search information 
Request: 526992Match: SGN-E526992
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C327684Clone name: PetuniaRF-1-D08
nocartOrdering Not Available
Library Name: Petunia-RFOrganism: Petunia hybrida

Tissue: whole fruit (ovaries)
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E526992Length: 422 bp (955 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E526992 [] (trimmed) CCATACACAACATTAGATGTAGCTCAACTCTTTTTAGATCAGATATTCAAATTGCATCGGTGGCCTCAGACAATTGTGTCTGATGGAGATGCTAT
ATTCTTGAGTAAATCCTGGAAAGAAGTTTTTAAGCTACAGAAGGTCAAGATGCACGTTTCTACAACTTATCATCCTCAAAGTGATGGTGAAACTG
AGGTATTGAACAGATGCTTGGAATGCTACCTAAGATGTATGGTTGCTGATAGGCCTAAGGAGTGGTGCAAGCGGCTTCCTCTCATAAAATGGTGG
TACACCACCTCATAGCATTCTGCACTTCAGACTTCCCTATATGAACTACTCTATGGGTAGCCCCCTCCACCCCTAGTTCCATACCAACCCTTCAA
TTCTCAGTTGGATTTGGCTGATAGAAGCCTGTAAACTAGAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E526992] SGN-U209991 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T337438 [Download] [View] Facility Assigned ID: PetuniaRF-1-D08.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0020 Quality Trim Threshold: 14.5