EST details — SGN-E527445

Search information 
Request: 527445Match: SGN-E527445
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C328137Clone name: PetuniaRF-6-B11
nocartOrdering Not Available
Library Name: Petunia-RFOrganism: Petunia hybrida

Tissue: whole fruit (ovaries)
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E527445Length: 643 bp (770 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E527445 [] (trimmed) AGTTCTCTCTCTCCNCTCTCCTCTGAACTGTTCTCCAATCCATTCTGACTGCAAGAATATAAGAAATTATCTTGAATTTGGAGTTGCAAGATGTT
AGAGACAAACGCAAGGCCTGAAGACAGTCTCTTCTCTCCAGGAATGATGAGATTCAATGGATATGAAAGGCAAGAAATTAACCATTATCGGGACA
GTTGATCCAGTGAGTGTAGTGAGCAAACTGAGGAAGTTTTGGCCGGCACACATAATCTCAGTAGGACCGGCGAAAGAGCCAGAGAAGAAAGAGGA
ACCAAAGAAAGAAGAGGGCAAGAAAGAAGAGGCTAAGAAGGAGGGCGAGGGAAAGAAAGAAGACGCACCAAAGGAGGAAGGAAAGAAAGAGGAGC
CTAAAAAAGAAGAAGACGCTAAGAAGGACGAAAACAAGAAAGACGAACCCAAAAAGGAAGAACAGAAGAAGGCACAAGCACAGCCACAAATAATG
CCAATGCCAATTCCATTCCCACAACATCAACAATATCATCCAGCTGTGGTTGGCATGGTACCGACCTATCGACCATATTATCCTCCTCCTCCCCA
TATGCAGGCCATGCCTTATAGGCCATATTACCCCCCTCCTGCACAAACATACTATCAGGTTCACCACAGCGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E527445] SGN-U210620 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T337891 [Download][View] Facility Assigned ID: PetuniaRF-6-B11.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0188 Quality Trim Threshold: 14.5