Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E527703

Search information 
Request: 527703Match: SGN-E527703
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C328395Clone name: PetuniaRF-8-H09
nocartOrdering Not Available
Library Name: Petunia-RFOrganism: Petunia hybrida

Tissue: whole fruit (ovaries)
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E527703Length: 443 bp (569 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E527703 [] (trimmed) GGACAAAAGGGTGCTATTTGTCCTCATAAGCTTCGCTGTGACTGGGATTCAGCACATCCAGTTCTGTCTGAACCACTTTGGTGCTGATGTCTATG
TTGGACAGCCCAAGGGGAACGATTGGTTCGAGAAACAAACCGCTGGAACTATCGACATTGATTGTTATTCTTGGATGGATTGGTTCTATGGAGGA
TTGCAGTTTCAGCTTGAGCATCATCTTTTTCCAAGGCTGCCTAGGTGCCAACTGAGGAAGATTTCTCCGATTGTACAGGAGCTATGCAAAAAGCA
TAATTTGCCTTACAGGAGTATGTCCTTCTATGACGCCAACTTATGGACAATAAAGACACTTAGGACTGCAGCAATGCAGGCTAGAAACCTGCTTT
GGGAAGCTGTTAACACCCATGGCTAGTATTTCTTTTGCACGATACTGAAGATTCTCGTAAGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E527703] SGN-U211313 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T338149 [Download][View] Facility Assigned ID: PetuniaRF-8-H09.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0041 Quality Trim Threshold: 14.5