EST details — SGN-E528078
| Search information |
| Request: 528078 | Match: SGN-E528078 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C321978 | Clone name: Petunia-PP-12-H01 |
| ||
| Library Name: Petunia-PP | Organism: Petunia hybrida |
Tissue: all floral organs
Development Stage: anthesis
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E528078 | Length: 260 bp (316 bp untrimmed) |
| Status: Current Version | Direction: Unknown |
>SGN-E528078 [] (trimmed)
CCTCGTGCCTTCTCATCATACTCTCTGCTACGGTTATTCATTGAGCTAAGCTAAAATTTTAAGAAATGGGGTCAGAAAGGACCCTCTATGCAATT
AAGTTTGCCACCAGGTTTTCGTTTTTATCCTACTGATGAGGAGCTTTTAGTTCAATATTTGTGTCGAAAAGTAGCAGGCCATGACTTCCCTTTGC
AAATCATTGGAGAAATTGATTTATACAAATTCGATCCTTGGGTTCTCCCAAGTAAGGCAATATTTGGTGA
AAGTTTGCCACCAGGTTTTCGTTTTTATCCTACTGATGAGGAGCTTTTAGTTCAATATTTGTGTCGAAAAGTAGCAGGCCATGACTTCCCTTTGC
AAATCATTGGAGAAATTGATTTATACAAATTCGATCCTTGGGTTCTCCCAAGTAAGGCAATATTTGGTGA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E528078] | SGN-U210748 | Petunia hybrida | Build 1 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T332404 [Download] [View] | Facility Assigned ID: Petunia-PP-12-H01.g |
| Submitter: Dave Clark | Sequencing Facility: U Fla ICBR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.969 | Expected Error Rate: 0.0171 | Quality Trim Threshold: 14.5 |
Working
