EST details — SGN-E528992

Search information 
Request: 528992Match: SGN-E528992
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C322893Clone name: Petunia-PP-5-D04
nocartOrdering Not Available
Library Name: Petunia-PPOrganism: Petunia hybrida

Tissue: all floral organs
Development Stage: anthesis

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E528992Length: 561 bp (975 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E528992 [] (trimmed) TCGGCACGAGGATTTTTCTTGGTTATAGTTGAATTTAGTGAAATGGCAAAAGCCCCAGAAGAAGAGCATCCATTGAAGGCATTTGGATGGGCAGC
TAGAGATAATTCTGGGGTTCTTTCTCCTTTCAACTTTTCAAGAAGGGCCACTGGGGAGAAAGATGTGCAGTTCAAAATCTTGTATTGTGGAATTT
GTCACACAGATCTTCACTATATCAAGAATGAATGGGGAATCACCAGATATCCCATTGTACCTGGGCACGAGATTGTGGGTGTGGTGACCGAAGTC
GGTACCAAAGTTGAGAAATTTAAAGTTGGAGACAAGGTAGGTGTCGGATGCCTGGTAGGATCATGTCAAAAATGTGACAACTGCTCAAATGATCT
AGAAAATTATTGTCCTAAACAAATAATGACATATGGTTATATGTACCATGATGGTACCATGACCTATGGAGGTTACTCAGATCTCATGGTGGCTG
ATGAGCATTTTGTCGTTCGTTGGCCTGAGAATTTGCCTATGGAAGCTGCTCCATTGTTATGTGCTGGAATCACAACGTATAGTCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E528992] SGN-U210321 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T331687 [Download] [View] Facility Assigned ID: Petunia-PP-5-D04.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0017 Quality Trim Threshold: 20.5