EST details — SGN-E530553
| Search information |
| Request: 530553 | Match: SGN-E530553 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C316282 | Clone name: cPHA-3-F16 |
| ||
| Library Name: cPHA | Organism: Petunia hybrida |
Tissue: stamens
Development Stage: stamens from open flowers on 18-20 week old plants
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E530553 | Length: 227 bp (710 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E530553 [] (trimmed)
CCAGGCTTGCTTCAATCGACTCTTTTGATTCAAAATGGAAGCAATTTTTGGAGCCTGGCGAATCTGTTCTTATGATCTNCATGATGAAAAAGATG
CAGAAGCTTACAAGCAAAAAGGGGGAGGGTATACTGACAAATAAGCCAAAGTTGATCTATGTAGACCCGTGAAAGTTGGTGGTCAAAGGGAACAT
TATATGGTCTGACAATTTTAACGATNTTAATATTGAA
CAGAAGCTTACAAGCAAAAAGGGGGAGGGTATACTGACAAATAAGCCAAAGTTGATCTATGTAGACCCGTGAAAGTTGGTGGTCAAAGGGAACAT
TATATGGTCTGACAATTTTAACGATNTTAATATTGAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E530553] | SGN-U210774 | Petunia hybrida | Build 1 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T322520 [Download] [View] | Facility Assigned ID: LIB4113-011-Q6-M1-F4 |
| Submitter: Koni | Sequencing Facility: Monsanto |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.969 | Expected Error Rate: 0.0314 | Quality Trim Threshold: 14.5 |
Working
