EST details — SGN-E531244

Search information 
Request: 531244Match: SGN-E531244
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C317055Clone name: cPHA-5-F23
nocartOrdering Not Available
Library Name: cPHAOrganism: Petunia hybrida

Tissue: stamens
Development Stage: stamens from open flowers on 18-20 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E531244Length: 314 bp (791 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E531244 [] (trimmed) GTCAGCAGCAGCCAAGCGATCTTCTATACCTCGCATGCCGGATGGCACCAAGGGATTCTGCATAGGTCGAGGTAAACCAGTGGCTATTAAAACAA
TGTGACGACTCTCTACTTACTTGAAAAGGCGGGCTTGTCACGTGAACATTTCTATACAGAGGATGGGATTGTTTCCTAGTTTTGCGGGTATTGAT
GGCAGGGTTTTTTAAACGCTGTCAATCCAGTGGAGCTGGAGCGATGGTTGATTTTGGCTGCTCGAGTCAAGAGGTTCATCTGTGGTCTATTACTA
AATCCATGAACCCCACACGGAAGCTGCGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E531244] SGN-U210021 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T323280 [Download] [View] Facility Assigned ID: LIB4113-019-Q6-M1-F11
Submitter: Koni Sequencing Facility: Monsanto
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.987 Expected Error Rate: 0.0105 Quality Trim Threshold: 14.5