EST details — SGN-E532970

Search information 
Request: 532970Match: SGN-E532970
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C312525Clone name: cPHA-10-E24
nocartOrdering Not Available
Library Name: cPHAOrganism: Petunia hybrida

Tissue: stamens
Development Stage: stamens from open flowers on 18-20 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E532970Length: 507 bp (722 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E532970 [] (trimmed) CTTGGGCTGTTGATGATTTACTAGGATTTTCTGATTACGAGACCGCTAACAAGAAGGAACAACTTGAGTTTGGTGAACTTGATTGGTTTACTGAT
ATGGGACTCTTTGGTGAACAATCAGCAGCAGCTGAAGTACCTGAGCTGCCACTGTCTCAGTCAAGCAATGCGAGTGCATTCAGGCAATCAAAGTT
CAACATGCCTAACAAGAAGCCAAGGATTGAAATACCAGATGACGATGAGTATTTTACGGTCCCAGATCTTGGTTGAACACCAATATTAGGAAGTT
CCCAAAAAATTTCTGTAATAGCAACTGGTTGCATTTTTGGATGATCAATGTAAATTTTGATACATGCTTATATGTATTAGTACTATATAAACCAG
TGTACTCATGACTGTCAGACAAACAGGTGTAGTAACATGGGAAAAGACATCCTGATGAAAGGTCAAAATTCTTTTTCATCCTTTTGATTGCATTT
AATCTTCCCTTGTTTGACTCAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E532970] SGN-U212247 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T325181 [Download] [View] Facility Assigned ID: LIB4113-039-Q1-M1-E12
Submitter: Koni Sequencing Facility: Monsanto
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0038 Quality Trim Threshold: 12.5