EST details — SGN-E533445

Search information 
Request: 533445Match: SGN-E533445
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C313281Clone name: cPHA-14-I13
nocartOrdering Not Available
Library Name: cPHAOrganism: Petunia hybrida

Tissue: stamens
Development Stage: stamens from open flowers on 18-20 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E533445Length: 485 bp (674 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E533445 [] (trimmed) TTGCTTCCGAAAAAAGGTCTTTGACGAGCCTTCCTGTTGGAGACCTTCTTAATTTTATCGATTACCCCAAATTCTCAGAAAATTAACGTCACATA
ATTATATCTATCTATCATTTGAAGTGATCAGTAGTATATATAATGGGGTGTCGCAGCAGCAAGGCACCTGATGCAAACACAATTTCAAGATGGCG
TTCTACTGGCATCGTTGCTTTACGTGACTCCAAATTAAAGACATTTCCTGATGAAGTTTTTGACCTGGAAAGATCTGTGCGTACGCTCGACTTAA
CACACAATAAACTTGTTGAAATTCCTATGGGGATCAACAAACTAACTAATTTACAACGTCTTATATTAGCGAATAACCTTATTGAGCGCCTTCCC
ATGAATTTGGGATTGCTTCAGTCTTTGAAAGTTGCTACACTTGATGGGAATCAGATCACTACCTTGCCTGATGAATTGGGCCAGTTGGTGAAACT
TGAGCGTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E533445] SGN-U210023 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T325709 [Download] [View] Facility Assigned ID: LIB4113-054-Q1-M1-A1
Submitter: Koni Sequencing Facility: Monsanto
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0169 Quality Trim Threshold: 14.5