EST details — SGN-E53383

Search information 
Request: 53383Match: SGN-E53383
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C44412Clone name: cLEG-68-F12
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C44412 [cLEG-68-F12] Trace: SGN-T78995 EST: SGN-E261311 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E53383Length: 244 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E53383 [] (called/trimmed by facility)
GAATCCCTACAAGCGAACCTCGCTTGCCCCTTTTCTCCACCCACCCACCAACAATTTCTCCAAATCCTCGTCTATTTTTCCTTAACAATCCTTCG
AATCATGGAGTTTTGAGGACAAAATTCGTTTCATACAAAGCTAAATCGAACCTAAACGATGTCGTTTCTTATACCGACACCGGTAAGAGCTTTTA
CGATCTTCTGGGTATACCGGAAAATGGATCTTTGTTGGAAATCAAGCAAGCGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T78995 [Download] [View] Facility Assigned ID: TBFKL30TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence