EST details — SGN-E536635

Search information 
Request: 536635Match: SGN-E536635
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C326903Clone name: Petunia-YF-3-B07
nocartOrdering Not Available
Library Name: Petunia-YFOrganism: Petunia hybrida

Tissue: whole fruit (ovary)
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E536635Length: 552 bp (598 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E536635 [] (trimmed) TTCAACCAACAATTATAACTGATGTGATATCCATGGAAATCTGGAAAGAGGAGGTATGGACCCGTCTTTGTGTCAAACTTTAACTGAGGAAGAGC
CATTGCTACAATGACACCAAGTATGGTGGGTGCTGCTATTGTCAAAAGATCTGAAAGGTGTGACGTTCACAAAGGCTTTTCAGTCGGATGTCTGA
TCACTGCTCACAGCCATGCTTTGGCAACCTCCATGGGGAGGTAAAAAGCGTAGTGGTTTTGGACGCGAACTTGGGGAATGGAGTCTTGAGAACTA
CTTAAATATTAAGCAGGTGACTCAGTATGCATCTGACGAACCATGGGCTTTTTACAAGTCACCTTCAAAGCTGTGAAAGTGATCAAGCAATTGCA
GTGAGTTGTGCCAGTTATGAGAACCAATGCCAAGGGAAGTGAACGATGAAGCAGACAGATGGAACTTGATGTACACTTAATGTTGTTTGTATTGT
TCGTTAGCAAGTCTAATAAATCTGTTCGAAGAGAAACATGGACGGCATATTTTTGCTGATATATCCTCTGTTCTTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E536635] SGN-U212074 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T336657 [Download][View] Facility Assigned ID: Petunia-YF-3R-B07.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0166 Quality Trim Threshold: 20.5