Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E536945

Search information 
Request: 536945Match: SGN-E536945
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C327118Clone name: Petunia-YF-5-D09
nocartOrdering Not Available
Library Name: Petunia-YFOrganism: Petunia hybrida

Tissue: whole fruit (ovary)
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E536945Length: 214 bp (713 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E536945 [] (trimmed) TGTTTGCTGGAGAGGAGACAATTGATTCGTTGAGGAAGCATGCCAAATACCAGAGACGAATGTTTGACCAAGCTGTTCAGCTTGTACGCCCAGGC
GGAGTTCTTGTCTATTCCACATGTACGATAAACCCTGGTGAGAATGAAGCGCTGGTTCGATATGCATTGGACACATATGAGTTTCTGTCGTTGGC
ATCACAGCATCCAAGAGTAGGAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E536945] SGN-U212446 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T336776 [Download][View] Facility Assigned ID: Petunia-YF-5-D09.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0105 Quality Trim Threshold: 20.5