EST details — SGN-E537687

Search information 
Request: 537687Match: SGN-E537687
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188908Clone name: TUS-56-G18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C48979 [cLEI-6-J14] Trace: SGN-T80942 EST: SGN-E266156 Direction: 5' Facility: TIGR
Clone: SGN-C188908 [TUS-56-G18] Trace: SGN-T338564 EST: SGN-E537689 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E537687Length: 790 bp (895 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E537687 [] (trimmed) CTTTGCTTTTTCCAGATAGAAACGCCCAAAGCTGAGTTCTTGCAGCCATGGCTGGAAGAAAAAGAAGAAAAACGAAGTCGTTGGCTGTGACAGCT
CCAAATAATGGTGCTGCTTCAAGTGAGGAGCGTGGAGAATCTGATGAGCAAAACTCATTGTTTTGTGTGCCGGTTGATATTCTAGAACAGATTCT
CAGCCGGTTAAACTTGAAGGAAAATATCCTTGCTTCTGCTGTTTGCAAGCAATGGCTTGCTGCTGCCATTTCTGTAAGAGTTGCGAATAAACCAC
CTTGGCTTATGTTTTTCCCCAAATTCGGTGACTTGGTTGAATTCTATGACCCTTCAGTGAGGCAAACTTATTCTGTTGAGTTACCAGAGTTACGT
GGCTCAAGGCTTTGTTATGCAAAGGATGGCTGGTTGCTGCTATACAAGCCCAGAACTTTGCGTGTGTTCTTCTTCAATCCTTATACGAAGGAGGT
GATCAATTTGCCAGGACTAGAATTAACATACCAGATAGTTGCTTTTTCGGCAGCCCCAACATCCCCTGACTGTATTGTTTTCACAGTTAAGCATG
TCAGCCCCACTTTGGTTGCAATTAGCACATGTAAACCAGGAGCAACTGAATGGACAACTGCCAATTACCAAAACCGTTTGCCATTTGTTAGCAGC
ATTTGCAATAAGATAGTTTTCTGCAATGGTCTCTTTTATTGTCTGAGTCTTACTGGCTGGTTGGGAGTCTATGATCCAGAAGAACATACTTGGCT
TGTTCGTGTGGTTCCACCTCCCAGATGCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E537687] SGN-U572812 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T338562 [Download][View] Facility Assigned ID: TUS56G18_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0121 Quality Trim Threshold: 20.5