EST details — SGN-E537864

Search information 
Request: 537864Match: SGN-E537864
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189011Clone name: TUS-56-L1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C49704 [cLEI-9-E14] Trace: SGN-T81689 EST: SGN-E265408 Direction: 5' Facility: TIGR
Clone: SGN-C189011 [TUS-56-L1] Trace: SGN-T348837 EST: SGN-E547962 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E537864Length: 524 bp (895 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E537864 [] (trimmed) CTCTCTCTCTCATCGCTGCGTAAAGCTATGAGTTTAATTGCAGGTTCATACGAGAGATTCATTTGGGGATTCAAGTTGAGATCCCTCAAAAACGA
TCAGAATTACGAACTAACCCCTCTATTCTCCTTCCCTTCACATCTCTCACCAATTAAATGCACCGCCGTCGCCGGTTCTGCCGCTGTATCCGGCG
GCGCCGATGACACTATCAAAATCTATGACCTTTCTACTTGCTCAGAAATTGGGTCACTACACCACTCCGCCACCGTTACTTCACTTTCCTTTTTT
ACCCCTTCTTCATTCTCCTTCCCTCGTAACCTTATTGCCGCGTCTGAAGATGGTTCGGTTTCCATATATGATGCTGATCCTTTTGTTCATCTCAA
GACGGTTAAAGTGCATCGTAAGGCAGTGAATTCTATATGCATTCATCCGTCGGGGAGGTTGGCATTGACTGTTGGAAGAGATGAATGTATGGCTA
TGGTTAATTTGGTTAGAGGAAGGAGAAGTTTTTATTGTAGGTTGGGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E537864] SGN-U572943 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T338739 [Download][View] Facility Assigned ID: TUS56L01_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0008 Quality Trim Threshold: 14.5