EST details — SGN-E538078

Search information 
Request: 538078Match: SGN-E538078
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189136Clone name: TUS-57-A6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C46836 [cLEI-13-N20] Trace: SGN-T82524 EST: SGN-E268463 Direction: 5' Facility: TIGR
Clone: SGN-C189136 [TUS-57-A6] Trace: SGN-T348872 EST: SGN-E547997 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E538078Length: 541 bp (887 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E538078 [] (trimmed) GGAAACATCTTCTTATCATTCACTGAAGGGCCTTACAAGTAACTTGGAAACAATTTCTTCTTTTAACAAAACATAGTTTTTTTTAAAAAAAAGTT
TCCCCCAAACAGAACTCCTAGATACCTATGTTGCAATGGGGGAACATGGGGGGATTTACAAGCTTTTAAACTAACTACTCAAAGAATGGCAACCC
TGCTTCTACTTTAACTTGGATCCAATCCCAACAAAATCCTTAACTGGAAAACCAACTTTCCCGAATTTACCTTTCTCATTTGGCACCCTAAAGTT
TAAATAGTCCGAGCAAACAAATGACTTGGAAAGTCTTGAATTTTTTTCACCAACTACTTCATCAGGGGCCAAAATCACCTTCTCATCCTCAAAGC
CCCCAAAGAAAACTAAAGAAAAGCGGTTCACCGGCTTCTTCAAAATGACACGGGGCTCAAAGGATCGTAGTTTGTCATTGCTCCAAGCTTGCAGC
ATGTCACCAATATTTACCACAAGAGTTCCTTCACATGGCAAAATATCCACCCACTTCCCATCCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E538078] SGN-U601717 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T338953 [Download][View] Facility Assigned ID: TUS57A06_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.910 Expected Error Rate: 0.0218 Quality Trim Threshold: 14.5