Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E538609

Search information 
Request: 538609Match: SGN-E538609
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189493Clone name: TUS-57-P3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C67672 [cLEN-1-M19] Trace: SGN-T87908 EST: SGN-E270603 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E538609Length: 1337 bp (untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E538609 [] (untrimmed)
TTTTNNNNNNNNNNNNNNNTTTTNNNNCCCCCNNNAACCCCCCCCCNAACCCCCCCCCCCCTNNCCNGCGGTTGTGGTAACGGGGCCCCGCGCGC
GAGGGTTGGGTTTTTTTCTATTAGGAGGGGGGGGNAGGAGTGTGAGTTTTTGTCTCAAAAAAAGATCTCCAGGTTGGCGTGAGCTAGAGGGGGGT
CAGTGCTGCAAGAAGGCGTGGCTATACTAGGCTAGTTGAGATTGTGCTCTAAGAATACCATGTGGTGTGTGTCTGTCTATTTGTCTTCGGCATTG
CGCGGGCCTGCCGAGGACGGGGAGGGGTATTTTGTCAAGTAAGGGGGTGGTGGAAACGTTTGCGCATGGACATAAGTGTGGAAGGCTGAAGAATG
CTCGGGAGATTCTTGTCACGTCTTGGGTCGTCCTTTCTTCATCTCTATTAGGTTCCTGCCCAGTACACTTTTTGTGGGCTGGGGGAGGGCGGGTT
TTCTGGTGCGGAGGTATCTGGTGTCGCAACGTCAGGGAGGTGTGGATTCGGTCTTAGTCCGGTTCTCTTCCGGAAGATCAGTTAGGTATGCATGG
CCGGTAGCTGACGAAAACGATTTCGGGTGCGTGGAGGCGAATTCCGAGCCTAGAGTAGGGGGTGCCGCTGTATAGGGAGTGTGCTGTGGGCGGGC
GCTCGTTCGTGGGGCTGGCGGTTCGTGTGCGCGCGCTTATCCTGTGAGATTAGGGCAGAGGGGTTGTGGGAGTGGGAGACTCGCTGTTGAGTATG
GCGTCTGAGCGGGCGCTGCGGTGGGACAGTCTGCGATCTTTTTGGTGGGGTATGTGTCGGCCGTGGTGGTGCGGGGGGTGATGGTGCTGGCGTGT
GGTGCGCGGGTTTGGCGTTGTTTGTTGGAGCGCCTCCCTGCCTCTCTTTGTTTTAGAGGACGTAGGTGAGGTTTTGCGTAGATCAAGGTGTGGGG
TTGTGTAGCTGATTATATGTGAATGGAGGCGGGATTCTGCCTCGCTTGTGCTGTGGGNCGGGCTGAGCAGCGCAGTCATGTGCACATGCTCGAGG
TTTGTTTCTGGATGCGGCGAAGGTTTTCGCGGATGCGTCTACTNGTGTTGGTGGTTTTGTCCGCCCTCGATTATCGCGCGCGGACGTTACNTCAC
NCTCGGGATTCTCATGTTGCAGTCGGCGTGTCGGCGTGTGTCTTGATTTGTGGTGATTTTAGTTGCGTCGGTGTTGATGTGATCCTAGTGATGTG
TACACTGCAGCGTTGCTGCACTTTCGCATGTTTGTGAGCGCTTTGTCTCGAGCGATGCTGTGGCGGCATTTGCTCGCTCTTCGTTCGTGTCGCGG
TGCGCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T339484 [Download][View] Facility Assigned ID: TUS57P03_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Problems: High expected error (low overall quality)
Sequence Entropy: 0.000 Expected Error Rate: 0.0129 Quality Trim Threshold: 20.5