EST details — SGN-E538700

Search information 
Request: 538700Match: SGN-E538700
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189546Clone name: TUS-58-B8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C69316 [cLEN-9-M1] Trace: SGN-T88955 EST: SGN-E275083 Direction: 5' Facility: TIGR
Clone: SGN-C189546 [TUS-58-B8] Trace: SGN-T339578 EST: SGN-E538703 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E538700Length: 754 bp (902 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E538700 [] (trimmed) GCTGTTTATTTATATGTGGTCACCTAATTCTAAATTAAACATAATGTGTATGTATATATATATAAAGAGGATAAAATCTAAAGAGTTTTCACTAT
AGTTTACAATTGAACGACTTCACAACTCAGACACAGTAAATTGTTGAACAAAAGCTCTACAAACCTCACCGACAACCAAACAAATACAAAGAAAC
AGAAATTTTTAACATGGCAAGACCAGCTTCTTCAAAGCCTGTATATAGAGTTGCATTCCAATATTATTTTTCATACAAAATGTTTGCATCTGCCT
GAAATATTCTGGTCCTGTAACCTCACAGGATGCGGTCTTGAAAATCGGAGATTAATGTTGATGCAAATGAGCCAAGTCTCTTTCCAGTTTCTCCA
GCCATGTTTTTCAGAGAGGACATGTCCTGTTGTGCCTGGAATGAGATCCGGTTAATGAGATCACCAGCAGTGAGGTCCAAATCTGATCTATCATC
GTCACCAAAAAGGTCTGCACTTGATATGGCACTTGAACCCGAGAACTTCTTAAGAGAAACTGAGGCTTCCATTTCAGCTTTGCTCTGATCACCAA
AGAATTGGGCAGATGAAATTGCTTTTGCATTAGTAAACTTCTTCCTTGCATCATCAGTTTCCTCGATTTGAACTTTGGGAGATTTTGAGCTTTTC
TTTGTGAAACCGCTTTCCATTCCATAGTCCGCAAAAAATTGGAGGACATTGGAGGGGATACATGGGTTAAGACACGTCCAGAACTCATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E538700] SGN-U582607 Tomato 200607 Build 2 51 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T339575 [Download][View] Facility Assigned ID: TUS58B08_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0045 Quality Trim Threshold: 14.5