EST details — SGN-E539080

Search information 
Request: 539080Match: SGN-E539080
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189767Clone name: TUS-58-K13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C73904 [cLER-7-A19] Trace: SGN-T93527 EST: SGN-E281064 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539080Length: 130 bp (848 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E539080 [] (trimmed) GAGAAAACAAAAAACAAGAAACCTTTTAAATAACAAGAATGGTTGCCTGTCTAATAATATCCACCTAACATGTTAGTCTGGCGATACAGTTCATT
CACCAGACTTAGCTGTTGTTGCAAACATACAGCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539080] SGN-U568259 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T339955 [Download][View] Facility Assigned ID: TUS58K13_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.919 Expected Error Rate: 0.0219 Quality Trim Threshold: 14.5