EST details — SGN-E539173
| Search information |
| Request: 539173 | Match: SGN-E539173 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C189821 | Clone name: TUS-58-M19 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C74442 [cLER-9-H21] | Trace: SGN-T93990 | EST: SGN-E278256 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C189821 [TUS-58-M19] | Trace: SGN-T340050 | EST: SGN-E539175 | Direction: 5' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E539173 | Length: 272 bp (936 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E539173 [] (trimmed)
GGAGGCATCTAGAATCATTTGCATACACAGAGGAAATTCATTCTTTTCATATATCAACTCAAAAGTGTGTAAAAACTGACACAAAATGGAAAAGT
ACAAAATTGGTCTATTACTCCATAGATTTCTTCAGTTCTCTTGAAGAGCCTTCATCAGATAGAGTCTACTGAAGCTCTGTCCAGCAACACCGTTA
ATCTGGTTGCAGTAGTTTGCTATTTGATTAGTTATGAGAAAGCTGTCCAATCGTGAGGGGTCTGGGATTGGCTTAAAGGCGG
ACAAAATTGGTCTATTACTCCATAGATTTCTTCAGTTCTCTTGAAGAGCCTTCATCAGATAGAGTCTACTGAAGCTCTGTCCAGCAACACCGTTA
ATCTGGTTGCAGTAGTTTGCTATTTGATTAGTTATGAGAAAGCTGTCCAATCGTGAGGGGTCTGGGATTGGCTTAAAGGCGG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E539173] | SGN-U580234 | Tomato 200607 | Build 2 | 31 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T340048 [Download][View] | Facility Assigned ID: TUS58M19_P1 |
| Submitter: Koni | Sequencing Facility: INRA (MWG) |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.964 | Expected Error Rate: 0.0126 | Quality Trim Threshold: 14.5 |
Working
