EST details — SGN-E539216

Search information 
Request: 539216Match: SGN-E539216
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189846Clone name: TUS-58-N20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C69688 [cLER-12-E5] Trace: SGN-T94225 EST: SGN-E283258 Direction: 5' Facility: TIGR
Clone: SGN-C189846 [TUS-58-N20] Trace: SGN-T340093 EST: SGN-E539218 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539216Length: 550 bp (889 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E539216 [] (trimmed) AAACCAAATGAATAACTTAAGCTCTAAAACGAGGGGGGGGGAAGCTTTTTTAAACAAATAAAAGGGCAAAAAGAAGGGTTTCTAAATCCCCAAAA
AAAGCCAACGGCCCCCTAGGTTTTAAAGGTAGCGCGGCACCCCCGGCTTTTTTTCCTAAGCCAACCCCCAAACCCCCAGGGACAAAATCAGTTTT
GCCCTTCACATTTTGACTACAATGGGCAAAATGAACATGGGCCTGGGGGGAATCCCGGTTATTGTTGCTTATATTGAAAACAAGATGGCCCTTTC
CTTTGATCTGAAAAAAATGGCCGGGGCCCTTTTTCATACTTAAACTGGGAGGAATCTGCATTTTTCCAATCCCTTCGGACTCAACCGATTTTTCA
ACACACCCAATGTCTTCGTTGTAACCCTTTTTCAAAAAATCTGAACAGTTTTTTTTTCCCCCCTGATCTTTTGGATTACGGAATCGACCCCCTGG
TCCTCTGAGGTAACCTGGGGCCAAATTCCTGCAGCCCGGGGGATCCCCTATTTTTAAAGGGGCCCCCCCCCCGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539216] SGN-U590410 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340091 [Download][View] Facility Assigned ID: TUS58N20_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.899 Expected Error Rate: 0.0219 Quality Trim Threshold: 12.5