EST details — SGN-E539292

Search information 
Request: 539292Match: SGN-E539292
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189889Clone name: TUS-58-P15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C70007 [cLER-13-E23] Trace: SGN-T94719 EST: SGN-E284025 Direction: 5' Facility: TIGR
Clone: SGN-C189889 [TUS-58-P15] Trace: SGN-T340164 EST: SGN-E539289 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539292Length: 698 bp (874 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E539292 [] (trimmed) CAAAGTCCACACAAAGTGACATGCTTTACATTGCTACTAGCCAAGGAGGCAGTATTGACATTGGATAATGTGGCCAAGAGAGGAATCTCTCTATG
CAATAGATGTTCCTTGTGGGGAATGCTAATGAGACAGTGAGACATCTCTTATTACATTGCAACTTGACTGGGCAACTGTGGCAGATTTTCCTTAA
TCTCAGAGGCATATCTTGATGTATGCCTAGCAAGATTGATGAGACTCTATTCGGTTGGGAGATGGCTGGAGTTGGGGCTACAAACAGAGAAAGAT
GGCGGATGATCCCTGCTAGTATTTGGTGGCTATATGGAGGGAGAGAAACGAGAGATGTTAAGAAAATAGGAACAAAAACCTGCAGGAAATTAAGC
TTAAGTGTGTTTTATTGTTCTGCTTTTGGTGTACAAATGTCTACTCCAATGAAACTGAGTCAATCATAGATGTTTTAGGATCCATTTAGATTTGG
TTCAGTTTTTTGGATTGATTATACTTACTTTCTGCTTTTGTAAATATGGTTTTTCAGTACTACCTAAGTACTATGTGAAATACAATGTTACAGTT
TAAAAAAAAAAATAGTTCAGAGGTGCAACGAATAAAATATACCAAGTTTAGGGTAACCTGATATATTCTGCCAATAAAAGATTACTCTACAATAA
CAACATACCCAGTGTAATTCCACGAGTGGGGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539292] SGN-U564730 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340167 [Download][View] Facility Assigned ID: TUS58P15_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0042 Quality Trim Threshold: 14.5