EST details — SGN-E539341

Search information 
Request: 539341Match: SGN-E539341
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189919Clone name: TUS-59-A21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C70311 [cLER-14-E5] Trace: SGN-T94988 EST: SGN-E281729 Direction: 5' Facility: TIGR
Clone: SGN-C189919 [TUS-59-A21] Trace: SGN-T340219 EST: SGN-E539344 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539341Length: 823 bp (916 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E539341 [] (trimmed) AGCAACAAGAAGATCACTACATTTCTTAGTAAATTGAATAACAAATCAAAACTTTATAAAGAGTTTTGCCTCAAATATGGTTGAATTATCTACAG
ATATAGGCACCATGTATTCACCAAGCATAAGAGATATGCTACACTTAATGCTAAGACTGCCCACTCATTCTTACAAGCTGCACAGGTATAAACCT
ACAACAACCAAATATTAACAATTTATATAGACAACGTATTCGGATTTATAGAGCACCTTAAAATGAAATCCGAAAGACTTTGAGGTTCAGCCCCG
CCCCAAGAACCTTGCTGACACATCTACAAGCTCCAAATAGTAACGTCCAATCAGCAGAGGTAACCCCTTAGCAGCCCCAACGCAGAGTTTAGGAA
CTCGCTCTCACAAGCTTCACTTGAAGAACCTAAAATGTCCGCTGTTAATTAGGTAGTTGAGCAAAAGTACCACTATTTGGGCTACAACCCCCGAC
CATCATTTTCTCATAAATGGCATATGCACCATCTGGATCACCAGACTTGCTGTACCCCCTAATAAGAGCATTATAAGTAAAAACATCGGGTTCAA
GACCGAGTTGCTGAAGTTCTTCATACATCCTTCCGGCCTCCTCCAACATTCCAACAATCCCAAGATTGAATATCAAGGTATTATAGGTATAAAGA
TTCGGGGTGATTCCTCTGCTTTTCATCTCATTAAGAAGATGCAGCGCTTCCTTCATTTTACCAGATTTCCCAAGACCGTTGATCATAAGGTTGTA
AGAAATCAAATCAGGATCAAGACCAGCTGATTTCAGTTCCCTCAAGTAGTGCAAAGCATCGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539341] SGN-U599371 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340216 [Download][View] Facility Assigned ID: TUS59A21_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0015 Quality Trim Threshold: 20.5