EST details — SGN-E539520

Search information 
Request: 539520Match: SGN-E539520
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190023Clone name: TUS-59-F5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C71785 [cLER-19-C1] Trace: SGN-T96523 EST: SGN-E284951 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539520Length: 568 bp (877 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E539520 [] (trimmed) CCTATTTTATGATGGTCTCTCCTTTACCATACAAGCTTCATAGATATTTAATTTGGGGGTTTATGAATTTGGGAATTTGGTTGTTTTTCTCCAAA
GAATGATTTATGTACTTTTTTTAAGCAAAAAAGAGTAAACCTGAGATTAACAAGATTGTGCGGAGTGGAGAGGAATCACAAATCAACACCCTCAT
CAAGCCCTTTAGAACTGATTATTACATTTGAGTTTATTTGTTCACCAAACTTCTGTTTACCGCGGATTTCAAAGTCTTTGAAGCCATCCATCTGT
TGAAATTGGTCCATGGAAATCGGATTTCCATGCAGAGATACAGTCTGCAAGCTCTTGCATTCTCTTAACAAATTTAGAGGCATCTGACTGAGATT
GTTATTGCTCCCGCCAACTGATTTTAGTTGAACAAGATTGCAAACTGATACAGGAAGTTCTTCGATGGAATTATCATTTGCTTGCAATTCTTCCA
AGAGAAGCAACTTCCAATTGATTCTGGGAAAAACTTTAACTTATTGTTTGAAATGTCCAACAATACCAAATTCTGCAAGCTCCCAATAGTCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539520] SGN-U583370 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340395 [Download][View] Facility Assigned ID: TUS59F05_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0256 Quality Trim Threshold: 14.5