EST details — SGN-E539722

Search information 
Request: 539722Match: SGN-E539722
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190141Clone name: TUS-59-K3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77626 [cLES-2-L19] Trace: SGN-T97063 EST: SGN-E281903 Direction: 5' Facility: TIGR
Clone: SGN-C190141 [TUS-59-K3] Trace: SGN-T340600 EST: SGN-E539725 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539722Length: 631 bp (886 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E539722 [] (trimmed) GGAAGAAAAGTAACTGAGTCGGATAATATTATCAGGTTTGCCAAAGGCTGGTAGGATAAAGATACCACCTCATCAAGTAAAGGAAAAGATGCATA
CAATATATTATTTTAGCATAATACACAGATATCTATTATAAAATACCGAAAATTGGAGGAAGACAAAAATAGACAAATATTAGGAGCCCACTGTT
CAACTAGACTTTCGTAATCCTAACTCAGTTGTGACGTATCTTAGCAATTGTTTCACCAACTCTCTAACTCTAGCTTCCCTTGATATAACAAGTTC
ACACAAGGATGGGAAAAGAACAAGTAAATGTGAACGCCTTTCTTGATTCTCTTTTCTGAGGCATTCTTTTAAGTAAGGATGTAAAGGAAGTTCAG
AAACAGTGTCTGAATGAACCACAAGAAGGGCAAGCTCTTGGAGGGTAAAGATAACTTCTTCCACACGTGCTGCTGGCAATGGATTTTCTCCTAAT
TTGCTCTCATCCATCAAGTACCTTTCCAGAATAAATTCACATCTGTTTATTAATATCTTTAATGATATGTTGCTTACTTCACATCTAGTTGAATT
CCATTCACCGGTTCCTCGACTGAAACCAAGTGAAATGACAATCACCGCAAACAAAAGAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539722] SGN-U575848 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340597 [Download][View] Facility Assigned ID: TUS59K03_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5