EST details — SGN-E539741

Search information 
Request: 539741Match: SGN-E539741
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190152Clone name: TUS-59-K14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77703 [cLES-3-A10] Trace: SGN-T97689 EST: SGN-E284668 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539741Length: 293 bp (899 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E539741 [] (trimmed) AATAAAGCTAATACAAGGTATTGGGCTGTTACTCAATCAACCATTCTGAACAAAATTGATTTGGGTACCATGCATTAAAAAAAATAAGTAAAACT
TCGTGAAGGGTAAAAAAAAAAGGAAGTTGTACAAATAATTAACAAAGAAGCAAGCCTTCACTTATTTGCTTCAATAAACTCTCTATACTCTCTCT
TCATTTTAACACCTGATACCGTCCTGAGCATCTCCTTGTTCTTGAAAAACTGTACACATGGAGTACCCATAATCCCAGCTGCCTCAGCAATCTCT
GGATCTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539741] SGN-U572332 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340616 [Download][View] Facility Assigned ID: TUS59K14_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0011 Quality Trim Threshold: 12.5