EST details — SGN-E53989

Search information 
Request: 53989Match: SGN-E53989
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77124Clone name: cLES-20-A17
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179228 is on microarray TOM1: SGN-S1-1-7.4.2.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77124 [cLES-20-A17] Trace: SGN-T102165 EST: SGN-E290486 Direction: 5' Facility: TIGR
Clone: SGN-C179228 [TUS-31-D10] Trace: SGN-T185543 EST: SGN-E373405 Direction: 3' Facility: INRA
Clone: SGN-C179228 [TUS-31-D10] Trace: SGN-T185544 EST: SGN-E373406 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E53989Length: 620 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E53989 [] (called/trimmed by facility)
CAAATATTTAGAGAAATATTATTTCAAGAACCAAATTCAATCTTTATCAAAGTTATGATAATGATAAATTTAATATTTTCAGCAATATTGGGTTA
TTCAGAAGGCTCAGGCAAACAAAATCTTGAATATTCAAGTTTTGGAATTTGAAATCTCAAGAAAAAATTAAAATCCCAAGCAAAATTGGGATGAT
TATTGCTTATACTCCTAGTTTAATTACATGTTTAAGCTTCTTTTGGATATTTCCAAATAGCGGAATCAGATTTTTCATGCTTAATTTCGCTATTA
CCATTCATTTTTTCAAAAGACTCCTTGAGGTTTTGTTTGTGCACAAATATAGTGGTTCCATGGCTATGAAATCTGCAATTACTATTTCCTCAAGC
TATTTTATAGCCTTTTCAAGCATAATATATATTCAACACTTGACCAAAGGATCAATAGAGCCAATAATTGACTTGAAGTATTCTGGATTTATTGT
ATTTTTAGTGGGAATTATTGGCAATTTTTATCACCATTTTATCCTTTCTAAAATAAGAAAAAAAAGTGAAAGTGGATATAAAATTCCTAAAGGTG
GCCTTTNTAACTTAGTTATATGTCCACATTACTTCTTTGAAATTGTCACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T102165 [Download] [View] Facility Assigned ID: TPSCY09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence