EST details — SGN-E540102

Search information 
Request: 540102Match: SGN-E540102
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190362Clone name: TUS-60-D8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C74648 [cLES-11-A20] Trace: SGN-T99868 EST: SGN-E286337 Direction: 5' Facility: TIGR
Clone: SGN-C190362 [TUS-60-D8] Trace: SGN-T349205 EST: SGN-E548330 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E540102Length: 500 bp (883 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E540102 [] (trimmed) TTTGCATTCAGGTAGAGGTTACAAATAGTCCACACCATCTTTATCACTCAACAGAAATCAACTTCAAATACAAATCCACCAACTAGTATTTGATA
ATTCTCTTGGTTTCTGGAGACATTGGCAATTTTTTCATCTCCCTAGATGATGGGAAAAAAAACTAGGCATTAGCAGTCTTAGGAATGAGAGGAAT
GGATTGATGTCCCTTTTGCTTCATTCGTGCTTCCTCTTCACGGATCTTCTGCATCTGAAGCATCCGTTCCATAACAAGCTCATACGCACACTTCT
CATATGTATGGCGCTCATCCTCGCACTTCCATGGAAGATAAAATTCCGATTGCCGACACTTGTTCAAAGGGATCAAAAGGTGTGCGCACTGATCC
CTATATGCTAATGGCACTTTGTTCTCCACCATTTCTTCTTGTGTTGCAATCATCTTCTTCGATGAACCTGGAACCTCCATTGCCAAATTGACTTT
CGTTTGTTCGATTTTGGGATTTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E540102] SGN-U568717 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340977 [Download][View] Facility Assigned ID: TUS60D08_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0003 Quality Trim Threshold: 14.5