EST details — SGN-E540608

Search information 
Request: 540608Match: SGN-E540608
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190655Clone name: TUS-60-P13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C87330 [cLET-4-A23] Trace: SGN-T103348 EST: SGN-E289677 Direction: 5' Facility: TIGR
Clone: SGN-C190655 [TUS-60-P13] Trace: SGN-T341480 EST: SGN-E540605 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E540608Length: 739 bp (894 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E540608 [] (trimmed) CGGTTATGGGAGGCTTGGTCATCGAGAACAGAAGGACGAGTTTGCTCCTCGACGAGTTGATGTTTTTACACGGCAGAATGTCTTGCCTCCAGATG
CAATAGTTTCAGCAGGTTCTGCCAGCTCATCATGTACTGCCGGAGGAGGGCAGCTTTACATGTGGGGAAAAATTAAGAGCACAGGAGATGATTCG
ATGTATCCCAAACCTCTTCTGGATTTGAGTGGGTGGAACCTCCGATGTATGGATTCTGGCTATATGCACCACTTTGTTGGTGCTGATTCCTCTTG
CATAAGTTGGGGCCTTGCACAGTGTGGGGAGCTGGGTTATGGACCACATGGACAGAAATCTTCTGCAGTTCCTAAGAAGGTGGACATTTTAGATG
GCATGCATGTTATCAGTGTTGCTTGTGGATTTGCCCACTCCATGGTTGTTATTGATAGGACAAATGTTGAGGATCGACTTGAGCAGCTTGATGTA
TATGATGGCAAGGCTTCTGAGGAAGTGGGGGCAGAACCTGTGAGTGAATCTCCAGCTTCTAAAAAGACTACCAAAAAGGCATCTGCGAAGGCGCC
TGCAAAGTCAAATAAACGGAAGAAGTCAAAAGATGCATCTGAATCTGAAGATGAGGAAGAGGAAAATAGTGATGATGAAAGTGATGACTATGAGG
AACAATCGAATGGGCGGGCCAAGTCTTCCGGCAGGGGTCGAGGAAAGGCTGCTGGCAAAGCTACAGCTGCTAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E540608] SGN-U567322 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T341483 [Download][View] Facility Assigned ID: TUS60P13_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0020 Quality Trim Threshold: 14.5