EST details — SGN-E540770

Search information 
Request: 540770Match: SGN-E540770
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190751Clone name: TUS-61-D13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C88295 [cLET-7-L17] Trace: SGN-T104121 EST: SGN-E291868 Direction: 5' Facility: TIGR
Clone: SGN-C190751 [TUS-61-D13] Trace: SGN-T349315 EST: SGN-E548440 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E540770Length: 488 bp (885 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E540770 [] (trimmed) AACCCCCCAAACCCCCAAAATTATTTGGTTTAAAAAATGTTTCTTTTTTGGCAAAAAAAAGGGGAAGTTTCTTTTCAACAAAATTTTCGGGGGAT
GTGCCAAATCCCCTTTAAAAAATGGAAAAAAACCCCCCCCCCCAAAGGGAAAGGGTTTTTCCAAAAACAAAGGTAACCCATTCCCCTTAACCTTT
GTTTTCAACCCCAAAGGGGGAGTTTTTCCCCCCCCCTGAAAAAAATTTTTTTTTGGCCGCAACCGGTTTTTTGCCAAGGGTTCCGGCCCATTTGG
GGCCAGAAATTCTGGCACCGGGGGCACCGGCTTCTTTGGGAGGGGCTTCCCCGGCCAAAAACCCCCTGATTCCCCGCCCCCGGAAAAAAAGGCCC
CCCCTTTTAGGAAAAAAAGGCCTTTTCTCCGGAGGAAAATTGGGCCGGCCCCCCTTGGGGAAAAAAACCCCCCCCAATGGAAGGACCCCAAAGGG
GGCCCCCCGGGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E540770] SGN-U601018 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T341645 [Download][View] Facility Assigned ID: TUS61D13_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.830 Expected Error Rate: 0.0332 Quality Trim Threshold: 14.5