EST details — SGN-E541001

Search information 
Request: 541001Match: SGN-E541001
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190884Clone name: TUS-61-J2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81199 [cLET-14-O20] Trace: SGN-T106281 EST: SGN-E294438 Direction: 5' Facility: TIGR
Clone: SGN-C190884 [TUS-61-J2] Trace: SGN-T349352 EST: SGN-E548477 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E541001Length: 611 bp (879 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E541001 [] (trimmed) TAAGTCTCCTGCTCGGGCATCTTCGATTATCATCCTTCAATATGAGTTTCGAGGATCATGGAAAACAGACCATTTCAGTCGGACCATGGGGAGGT
GAAAATGGATTGCACTGGGATGATGGAGTTTATTCCACCATAAGGAAACTGGAAATAGCTCACGGAACAGGAGTTGATTCGATTAAGGTTGAGTA
CGACAAAAATGGAACCTCAGTAATCTCCGAGAAGCATGGTGGTGGTGGAGGTGCTAAAACAGACAAGATAATACTTAGCTATCCAGATGAGTTTC
TAATTTCTATGAACGGATATTATGGTAGCTTGTACGAAAGGGGGTCAGTTTTTGTTCGATCACTTACATTTGAAAGCAACAAAAGGACGTATGGA
CCATATGGTGTCGAGCAAGGAACATATTTCACTCTACCAATCTCTAGGGGAAAAATTGTTGGCTTTCATGGAAAATGTGGCTGGTATCTTGATGC
TATTGGAGTATACATAGAGCCTATTCACAAGTCTTTGCCGACTCATTCTGTAGCTCAATCTCAGCAACTCCGTTCTATCGGTCATTCCCATCAAA
GCATTGTCCAAGGGATGGCAACTTATGAATACTCAATGATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E541001] SGN-U581642 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T341876 [Download][View] Facility Assigned ID: TUS61J02_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0107 Quality Trim Threshold: 14.5