EST details — SGN-E541160

Search information 
Request: 541160Match: SGN-E541160
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190978Clone name: TUS-61-M24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82768 [cLET-21-H14] Trace: SGN-T107883 EST: SGN-E293761 Direction: 5' Facility: TIGR
Clone: SGN-C190978 [TUS-61-M24] Trace: SGN-T349379 EST: SGN-E548504 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E541160Length: 500 bp (912 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E541160 [] (trimmed) GGTTAAAAACAACCTTGGGCGGGGCCCAAATCCCTTTTCTTTGGGGGGGCCCCCCAAAAAAAGTTCCCCCCCTTGAAAATGTTTTCCTGAAATCT
GTCCCGGGGGGGCCCCTGGGCCCCACCAACTTTTTTATTCCGCCCAAACAATTTTAGCAAAAACCCCTTTGGGTTGAAAACCCCCCCCCGAATTT
TTAGAGCCCCCAGAACCCCCCCCCGGGGTTTGAGCGGGCCTTCCCCTAAAAACCCCCCCCAAGGGATTTTGGGCGGGGGAAAACCAAGGGAATCC
TTTTTTTTTTTCAAAAAAAACCCCCTTAACCTTTAGGGCGGTTTTTGCAAATTTTTCCCTGAAAAAAAAACCCTTCCCCCCCCCAATTGTTTGGG
GTTCCCCAGCACCCCCTTTTTTTGGATTAAAAAAAACTCCCTTTTTTCCGGGTGGGGCCCCCCCCATTTTGGGAATACCCTGGGGTTGAAGTCCC
CAAACCCCTTTTTTTGCCCCTCCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E541160] SGN-U599331 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T342035 [Download][View] Facility Assigned ID: TUS61M24_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.276 Expected Error Rate: 0.0055 Quality Trim Threshold: 20.5