Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E541701

Search information 
Request: 541701Match: SGN-E541701
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191293Clone name: TUS-62-K3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C89952 [cLEW-1-A6] Trace: SGN-T112070 EST: SGN-E299840 Direction: 5' Facility: TIGR
Clone: SGN-C191293 [TUS-62-K3] Trace: SGN-T342579 EST: SGN-E541704 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E541701Length: 607 bp (872 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E541701 [] (trimmed) GGTTTAAACTTTCATAACTTGAACTTTAAAGTAGTGTTCATCAAGAAAATGTTCCTGAAAACTCAAAAAAATCTGCACACAACTTCACAATCACT
ACCTAGGCAACTCATCAGTAAATAAACATGAAAGTGGTGCAGTAGAAACAGAAACAAATGTACCATCAACATTTCCATTAGCCAAACATGATGTA
TGTCCTCTTGAAGATGCTAAAGAATGCATACATTCGTTTTCTTCGAATCCAAATCCTCCATTATAATCACCAGGAGCCATTGGAGCATCAGGTAT
ATCAGCTTCACCTTCCAAGTAACTCATCACTTGTCTCATGCTAGGTCGAGACGACGCCTCATTGTTTGAACACATTAGTCCTAATTTCAACACCA
TCACAACTTCACTTTCATTGAACTCACCTTTCAATCTCTTGTCTATAACATCAAGAATTTTCCCCTCTCTCCATTTGTTCCACACCATGTCTACT
AGAACTAATTCCTCTGGCCCCACCTTTGAATCAATCGGTCTACGTCCACATACCACTTCAAGCAACAACGCACCAAAGGCAAAAACATCGGATTT
TTCAGTAGCTCGTCCTGTTCCTGGTAATTCCGGGTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E541701] SGN-U601609 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T342576 [Download][View] Facility Assigned ID: TUS62K03_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0023 Quality Trim Threshold: 14.5