EST details — SGN-E542402

Search information 
Request: 542402Match: SGN-E542402
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191701Clone name: TUS-63-L3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C89728 [cLEW-19-E17] Trace: SGN-T113616 EST: SGN-E302192 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E542402Length: 721 bp (908 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E542402 [] (trimmed) AAAATTAAATAAATACTTGTTAAACAAATAAAAAACATTACTACATACTAAAAAAAATATAACAAAGAATCGAAAATAGAAGTAAAGAATGTAAA
TCAACTACCTATAATTTCTTCATAATAGGGAAGGAATAAACAAGAAAAAGAAAAACTTGAACTAAAGTTTAATTAGTACCTTTTACAAATTACAG
TCAACTAAAGATACAGAACTGATTAATTTGTTTCCCCATTTTTTAAATTTATTTTTTAATTTTCCTTTCAAAATAAAGATAGTTAACTAAATTTA
AATTTTTGAAGGCCAGTTTTGAGGCCTAGTGTTTTCAAATCATGTTGAACTTGTGCTCGAAAATCTGCGTAGCTGAAAGGGTTGTACTTTGTGCT
TTGAATGATAGTATCTTCATCAGGGAACACAAAATAACCAATTGATATTCTCTCCTTGTGTCTATTCACCTTCACTCTATGCTTCACACTCATAT
ATCTATCATCACTCATTGCCTGCAACATGTCACCAATATTGACAATAAGAGTATTAGGGAGAGGATTGACATCAATCCATTGATGATCTTTGTAA
ACTTGAAGTCCACCAACATCATCTTGGTGAATTATAGAAAGTACTGAGCTATCTGTGTGTGTGTCAATTCCCCATGTTCTTTCTGGCTCTAGGCA
TCTTGGGTAACGATATACCCTTAATAAAACAGTCTCTAGGGGACATATAATTGACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E542402] SGN-U570161 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T343277 [Download][View] Facility Assigned ID: TUS63L03_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0012 Quality Trim Threshold: 14.5