EST details — SGN-E542500

Search information 
Request: 542500Match: SGN-E542500
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191758Clone name: TUS-63-N12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C90242 [cLEW-20-G4] Trace: SGN-T113814 EST: SGN-E299553 Direction: 5' Facility: TIGR
Clone: SGN-C191758 [TUS-63-N12] Trace: SGN-T343377 EST: SGN-E542502 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E542500Length: 738 bp (912 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E542500 [] (trimmed) GAGGGGGCCAAATTTTTACATTTAAAATAGAACTGAAAACCAGCTATTTCCAGAGGTACAAGTGTGGTTCCTTGGATGGAAAGCCTTTCTCTATT
ACCTTGGCTATACATGCTCGCGTTAACAACATACCCAATATATTCCCAAAACAAGTGACATCTAGAAAGGGTGGGGTGTACACAGACCTTACCCC
TACCTTTACAGGGTAAGTGGAGTAAAGAGGTTGTTTCCTGTAGACTCCTGGATCAAGACTCTGTCAGCTTTAGAAAATATGTATACAAGTACGAT
TCTTCATCTAGATTCAACTTCCAATTAAATGTCAGTGCATGTTGATTTCACCAACATTTTCTTCATTCTTGCTCTCCGTTTCCTCAACTTTTAAT
TTCTTTGCTGCAGAAGAGTTCTCATTTGATAAGCGTGCAAACATTGTTGTATAGAGCTTTGCGTCTCTCTTGTTGCTCTCTGATTGGAGTTGTTT
TAGTGTCTTCTGTATCAGTTTCACCTCCCTGTTTTGTGGCTCTATTGCTAGTGCCTTCTTGATATCCAGTTCAGCCAAGTGCAGATCAGCTGTTT
CCATAAATGCTTGCGCTCTCCTATATAATGCTTTCACATTGCAGGATTCAACTTCTAAGACCTTGCAACATTGCTTGATTGCTTCCTGGAAATAA
CTCTGTTTGAGACAAGCAGCAGCACCATTCAACCAGCATGACACTCTCAATGATTTAACTATCTTTTGATCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E542500] SGN-U598814 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T343375 [Download][View] Facility Assigned ID: TUS63N12_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0082 Quality Trim Threshold: 14.5