EST details — SGN-E542531

Search information 
Request: 542531Match: SGN-E542531
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191776Clone name: TUS-63-O6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C90300 [cLEW-20-O18] Trace: SGN-T113890 EST: SGN-E299629 Direction: 5' Facility: TIGR
Clone: SGN-C191776 [TUS-63-O6] Trace: SGN-T343408 EST: SGN-E542533 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E542531Length: 854 bp (865 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E542531 [] (trimmed) GGGTACGGGCCCCCCCTCGAGTTTTTTTTGTTTTTGATGTTGAAACGGTTTTTCTTTATCCACGGGCAATGAGTTTCGACGTATTGGGTGTATCT
GTATTTATAGAAGCTTTCATTTTCGTGCTTATCTTAATTTTCGTTTAGTGCTAATAGAGGATAGAAGCAGATGCTCCTTAACAGTAAAAATATGC
ACTTCCTCAAAACAAAAGAGTATTGTTGCATAGGAAGATTTAAGTAATAATAGATGATAGAAGCGTGCGTGTTTTGTAACAGTAACAATATGTAA
TTCCTCAAAGCAAAAGAGTAGTCTTGCATCTGAATTATTAAGTCTAACTAACTGGATGTAAAAATATAGGGAAAAACACTACCTCAGACAATATT
CAGATCGATAAGCAACAAAGATGTTGTATTATTTTAAAACAAATCATTCTACAATCCGCAAACTCACAAAAATTTCAATTTTACAACAACATACA
TAGTGTAATCCCACAAGTGGGGTCTGGGGAGGGTGGTGTTCATGCAACCTAACCTCAAATTCCATCATTTTCAAAATGAAAGCTTCAAAGAACAT
ATTATCATTTTCCTCGTTGAGCTTGAAGAGATATCTAAAAGGTTTTCTCCCGAAACCAAGTGTACTATTCTCTGTTATAACTAAAAAGTAACTCC
TAGAAGTTATGTCCAATAAGTCTCTCACTGTTGGAAATTGGGTTATAAATAAGCGATCAATCTCCCACCAGTCCACACAAAGGAATTAGACTAAC
ATCCAGAGTTATCACTCATTTTATCAAGAAGCAGATGGTAAGAGCATATTAAGGACAACTTAGTTGTCACAAAAGTTAGCAAAGGGTTGATGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E542531] SGN-U595606 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T343406 [Download][View] Facility Assigned ID: TUS63O06_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0014 Quality Trim Threshold: 14.5