EST details — SGN-E542912

Search information 
Request: 542912Match: SGN-E542912
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191994Clone name: TUS-64-H8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C91250 [cLEW-26-I7] Trace: SGN-T114709 EST: SGN-E302877 Direction: 5' Facility: TIGR
Clone: SGN-C191994 [TUS-64-H8] Trace: SGN-T343786 EST: SGN-E542911 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E542912Length: 352 bp (911 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E542912 [] (trimmed) GTTATGACTCATTGGGATGGATTATTGACTAAACCAGGCGAGCGTATTCTTGTTCTTGCTGCAACCAACAGACCTTTCGACCTCGATGAAGCAAT
AATCAGACGGTTTGAGCGCAGAATTATGGTCGGTTTACCTGCAGCTGAGAATAGAGAGAAGATTTTGAGAACTCTTCTAGCAAAGGAAAAGGTAG
AAGATCTTGACTTTAAAGAGCTCGGAGTCATGACCGAAGGGATATAGTGGAAGTGATCTTAAGAACTTGTGCACAACAGCAGCTTACCGGCCTGT
CAGAGAGCTTATACAACAAGAGAGAAAAGAAGATTTGGAAAAGAAACGGAGAACTGAAGAAAAGCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E542912] SGN-U566431 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T343787 [Download][View] Facility Assigned ID: TUS64H08_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0066 Quality Trim Threshold: 14.5