Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E543346

Search information 
Request: 543346Match: SGN-E543346
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192247Clone name: TUS-65-B21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C94863 [cLEX-6-A13] Trace: SGN-T116014 EST: SGN-E303996 Direction: 3' Facility: TIGR
Clone: SGN-C94863 [cLEX-6-A13] Trace: SGN-T116152 EST: SGN-E304134 Direction: 5' Facility: TIGR
Clone: SGN-C192247 [TUS-65-B21] Trace: SGN-T349738 EST: SGN-E548863 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E543346Length: 619 bp (925 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E543346 [] (trimmed) AAGGGAATTAGAATCTTTAAACAATATGATTGGAGGGCTGCTAGTTCCAAAAGAATAAAAGAACGAATAAAATGGCCCTTTAGATTTCAGCTAAA
TGAGCTATTATTCATCAACTATCCCTTTTTCTTCGCGATGGAAAACATTCCCCTCGCTTCAAAACTTCAAGTTAGAAAAATATAAATATTCCGAG
CATTCTATGATCCTAGAAATATACGCGGAATCCTTACTCTGAAAAAAAAAACTGATGGCCTACACGTTGGGGATTAGCAAAAAAAATGAATCGAA
CCCACGGGGGGAATGATGGGACCATTAAAAAACATGCGGTTAAAAGGAGCATACTGAACTCTATCACTTTGATTCCTTCGATCCTTCATAGCCGG
AGGGGTTTTTACTGGCCCAGTTCCACTGATCCCGGCACATATCTTCAATGCCATATTTAGCCCCCCAATTCAATTCTCGTTCTGGTTTCTCTGGT
GCGGCGTAAACAATTTCAGCGTCCCCAGGTCTTCGACCAGACATCACCAGGGGAATTTTCTTTCCTGAGGCCTTCTCAAAGGCTGCCACCACTTC
CAAGACGGAGGATCCTTTCCCAGTTCCCAGGTTGGAAACTTCCCAACCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E543346] SGN-U567238 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T344221 [Download][View] Facility Assigned ID: TUS65B21_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0201 Quality Trim Threshold: 14.5