EST details — SGN-E543392
| Search information |
| Request: 543392 | Match: SGN-E543392 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C192274 | Clone name: TUS-65-C24 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C94954 [cLEX-6-I23] | Trace: SGN-T116060 | EST: SGN-E304042 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C94954 [cLEX-6-I23] | Trace: SGN-T116200 | EST: SGN-E304182 | Direction: 3' | Facility: TIGR |
| Clone: SGN-C192274 [TUS-65-C24] | Trace: SGN-T344268 | EST: SGN-E543393 | Direction: 5' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E543392 | Length: 213 bp (823 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E543392 [] (trimmed)
ATTTATTGAGCAATCAAAACAAGAAGATACAATGTCTACATAATTAACAAATTAACACACAACTCTACAAAGTCTCTCCATTCGCAATTAACTTG
CTTTATGGAACAGAGGCTCTTGAGTAAAAATCACAATTACACTGGAAAACAATCAAATTCTTGAAACAATTATTCATGAATCAACATTATCTTAG
ACGTTCACCTTTCCTGCAGTTTA
CTTTATGGAACAGAGGCTCTTGAGTAAAAATCACAATTACACTGGAAAACAATCAAATTCTTGAAACAATTATTCATGAATCAACATTATCTTAG
ACGTTCACCTTTCCTGCAGTTTA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E543392] | SGN-U576374 | Tomato 200607 | Build 2 | 23 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T344267 [Download][View] | Facility Assigned ID: TUS65C24_P1 |
| Submitter: Koni | Sequencing Facility: INRA (MWG) |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.882 | Expected Error Rate: 0.0016 | Quality Trim Threshold: 14.5 |
Working
