EST details — SGN-E543392

Search information 
Request: 543392Match: SGN-E543392
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192274Clone name: TUS-65-C24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C94954 [cLEX-6-I23] Trace: SGN-T116060 EST: SGN-E304042 Direction: 5' Facility: TIGR
Clone: SGN-C94954 [cLEX-6-I23] Trace: SGN-T116200 EST: SGN-E304182 Direction: 3' Facility: TIGR
Clone: SGN-C192274 [TUS-65-C24] Trace: SGN-T344268 EST: SGN-E543393 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E543392Length: 213 bp (823 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E543392 [] (trimmed) ATTTATTGAGCAATCAAAACAAGAAGATACAATGTCTACATAATTAACAAATTAACACACAACTCTACAAAGTCTCTCCATTCGCAATTAACTTG
CTTTATGGAACAGAGGCTCTTGAGTAAAAATCACAATTACACTGGAAAACAATCAAATTCTTGAAACAATTATTCATGAATCAACATTATCTTAG
ACGTTCACCTTTCCTGCAGTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E543392] SGN-U576374 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T344267 [Download][View] Facility Assigned ID: TUS65C24_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.882 Expected Error Rate: 0.0016 Quality Trim Threshold: 14.5