EST details — SGN-E543397

Search information 
Request: 543397Match: SGN-E543397
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192277Clone name: TUS-65-D3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C94970 [cLEX-6-J23] Trace: SGN-T116108 EST: SGN-E304090 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E543397Length: 769 bp (899 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E543397 [] (trimmed) AGAATAACTCACTACCTTGTATGGAATCCGAATTTATTAAGCTCTTCTTCCTCACTCTACACAATTTTCTTTCCATCTGAAACCAAAGATAGTAA
GTAAACAAACATACATTTCTATGGTATGGACAACTTGCAGCTTTTCATTAATACTGCTTTTGTCCAAAACACTGACACTGGTATTAGCAGCTTGA
AAGCCCGAGTGGTAAACCCGATCTCTAGTTGCTTTTGTGTTAACAAATGCCACTTCTTAGAGCCCTTTACCTCCTATGCTGTGTTTCATCTTCTA
ACCAGAAGCTTTCAAACTCAATAAGTCATCTATATCTTGTGAACACTGTAACCGGCATCCTCCGATGTCATGTTCTCCTTCCAGTTCTCAAATTC
AGATCCACCAAATACTACTTGTTTGATACCGACATAACATATGCGAGCCACGTTATCTTGAATCTCAACATCTCCAATATTATAGAATGTAGTAG
GTGTTACATTTGCCCCCTGAACAGCATCATAATTTGGTCTTTTGTCCAAAGGAGATTGGGACAATTGCATATTCATCGAATTACATCCACCAAGA
CGTCCAACAATGTGCCAAGACCGAATTGTGTCACAAATCAAGGAGATGTCCTTCTCCAATGGGGCATTGTAGAACTCAAACCATATAAAGGTGTT
TGAATAATCAAATTTGTTGAATTCGACTGTCATGGGTGTTGGTGAACCTGTCTTTGTATGAACAATTTTATTCCTTTTCTTTCTCAATCTCTCCT
CCAACCTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E543397] SGN-U583770 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T344272 [Download][View] Facility Assigned ID: TUS65D03_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5