EST details — SGN-E544270

Search information 
Request: 544270Match: SGN-E544270
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192785Clone name: TUS-66-I7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C95624 [cLEY-12-J8] Trace: SGN-T119191 EST: SGN-E307482 Direction: 5' Facility: TIGR
Clone: SGN-C192785 [TUS-66-I7] Trace: SGN-T349890 EST: SGN-E549015 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E544270Length: 808 bp (850 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E544270 [] (trimmed) AAACCACTAAATATAATTGCTATTGACCATCATGGATAGAAGAGACACTTACAGAATCCAGTAGAAAGCTGTATCAGATTATATTTCAACTGTGT
ATAACACAGCAAACTTTCAAATCTACATATATATTCAAGTATAATATCTGTGTTTTCATCTTCAATTACTCAGATTTGTATTCATCGTCAATTAC
TGAATCAAGGCGCCATTCACTTCCATAATAGGAGTTGGGCAATCCCAACCAGAACTTGAATGCTTCAGCTGCTCGTTTTCGTTCCTTTCTCCTGT
CCTGTCTAGCTCTTGACGCGTGCTTACTAGTAAACATCCTTGAATGCATCTCGACGTAGATCCTAGTAAACTTGGTCTTATTTGGTGGTATCCCG
TGTTGCTCCATGCAAGCAACGATCTCCAACGCTTTCCTAAAGAAAGCTGCTCGGACACATATGTCTGCTAATGTATCCAACAGTCCTTCATCAGG
TTCCAATGGCGGGAGGAGGCCTGAAGACGGAGTAGACTCCTCTCCATTTCCCATTCCACACCTCTGTTTTATCTCATTCCAAAGCAAGAGTGCTT
CTCCCGGCTTCCTAGCCAAAGCTATTCCATTTGCAAGACTGCCATAAGTGGCTACGTTTGGGTAGAATCCGTTTTCTTTCATCCTCTCGATCACA
CTCTTTGCTTCCTCAACCTTTCCTAGCTTAGAGTATGCATCTAACAGCATATTCCAAGCAACCAAATCAACCTTCACTCGAGGGTCTTTAAGCAT
CTCGTCAAACACCCTGTTAACTAGCTTAGCCTGACCAGATGAGGCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E544270] SGN-U603821 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T345145 [Download][View] Facility Assigned ID: TUS66I07_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0019 Quality Trim Threshold: 20.5