Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E544280

Search information 
Request: 544280Match: SGN-E544280
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192791Clone name: TUS-66-I13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C95649 [cLEY-12-L17] Trace: SGN-T119158 EST: SGN-E307449 Direction: 5' Facility: TIGR
Clone: SGN-C192791 [TUS-66-I13] Trace: SGN-T345156 EST: SGN-E544281 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E544280Length: 770 bp (888 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E544280 [] (trimmed) GTAACATATAAATGTTCAGACTGCAAAACACCATCATCCTTCAATTCTCTTCACAAATCAAACTGAATTTTTTTAAAAAAAAGGAAAGGGAAGGG
GTAGCTGGTCCATATTAACCATATTGTTTCAACGGAAACAGAGAGAAGTGAAAAGGCTTAAAAGGAAAGAAATCATTAGCCTCATAAGTCATAAC
TGTTGGTTGAGATAATGGTCTGGATCTGACTTCCCTCCACCACCCAAATACCCTGCAACAGTTCCAAGAACATTTGAAACAGTACCACTCAACCA
GGAGGTACTTCGAGTTAATAAGCCTGTCGGTGTCTGCCCCACCTCTTCAAGCATAATTTCTGGGTCTTCTGCCAATAATATGTCAAGCCGCCGCT
TAATCATATAAGCCTTTACAGCTTCAACCCCCTCAACTACGACTTCCTTTGGAGGTATCACAAGAGGATTTTCATCCAACTTAAGCACAGTTAGG
TTGTCAAGCCGGCTAATTGTGTCAGGCAGTTCATGGATCTGGTTGTTGCTCAGATCAAGTTCCTTGAGATTTATCAAGTCACCAATTGTGTCAGG
AAGCTTAGTTAGGTCACTAAAATTGTTGCTCAAGTTGACGATCTCAAGATTTGTCAAGTTCCCAAATGAAAGTGGAAGCCCATGTAGTTCATTAA
AGTGCACATCTAGAAGGCGCAGGGACTTCATCTCACCAAAAGAAGTGGGTAACGAGCGGAGCTTATTAAAAGGAAGTGAAAGCCTTTGCAGATTT
ACCAGTTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E544280] SGN-U600299 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T345155 [Download][View] Facility Assigned ID: TUS66I13_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0065 Quality Trim Threshold: 14.5