EST details — SGN-E544351

Search information 
Request: 544351Match: SGN-E544351
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192832Clone name: TUS-66-K6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C95873 [cLEY-13-J9] Trace: SGN-T119391 EST: SGN-E306213 Direction: 5' Facility: TIGR
Clone: SGN-C192832 [TUS-66-K6] Trace: SGN-T349903 EST: SGN-E549028 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E544351Length: 643 bp (902 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E544351 [] (trimmed) GATGATGGGTCGCTACACCGAGCCCATTGAGGACTGCCCTTGCGGTAACACCATCGGTCTCGTCGGCATTGACCAGTTCCTCGTCAAGTCCGGCA
CCATCACCACCTCCGAGGTTGCGCACAACATCAAGGTCATGAAGTTCTCCGTGTCCCCCGTCGTGCGTGTCGCCGTCGAGCCCAAGAACCCCGCC
GATCTGCCCAAGCTCGTCGAGGGTCTTAAGCGCCTCTCCAAGTCCGACCCCTGCGTGCAGTGCTTCATGGAGGAGTCTGGCGAGCACATCGTCGC
TGGTGCCGGTGAGCTCCACCTCGAGATCTGCCTGAAGGATCTCCAGGACGACTTCATGAACGGCGTCGAGCTCAAGATCACCGACCCCATCGTGT
CTTACCGCGAGACCGTCACCGCTCCCTCGGACCACGTCGTCCTCTCCAAGTCGCCCAACAAGCACAACCGTATCTACCTCAAGGCCGAGCCCATG
CAGGACGGTCTCGCTGAGGCGATCGAGGGTGGCAAGGTTGGTCCCCGCGACGATCCCAATGTCCGCGGCAAGTTCCTCGCCGAGAACTTCGGCTG
GGACGTCACCGACTCCCGCAAGATCTGGTGCTTCGGGTCCGATACCACCGGGCTCGAACCTCCTCGTGGACGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E544351] SGN-U571908 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T345226 [Download][View] Facility Assigned ID: TUS66K06_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0037 Quality Trim Threshold: 14.5