EST details — SGN-E544578

Search information 
Request: 544578Match: SGN-E544578
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192964Clone name: TUS-66-P18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C96619 [cLEY-16-M7] Trace: SGN-T120064 EST: SGN-E307710 Direction: 5' Facility: TIGR
Clone: SGN-C192964 [TUS-66-P18] Trace: SGN-T345452 EST: SGN-E544577 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E544578Length: 1157 bp (untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E544578 [] (untrimmed)
ATTTTTTNNTNANNNNNNNNGTNNAACAATCATANCCCNNCCCGNACAATATTGTCACNAACTACCCAAGATCCAGGTAATTACTTCGCCTATGG
GAGGGCCGGCTTTAGGAACTAGGGGGAGTCCCCCATTATCTTACAGTGTTTTTCGGGCGTCCAGGGCTGTTTCCCCCTGCACTTTATAAGCATCG
ATATTCTCACAGGAGTAGCGTACTCTTATAGGCTAAACTATTACCTATAATAGCACCCTCCGGTAGGAAACAAAAACCATTCCCGCGGAATAATA
AATTTCTTGAAGACAGGTAAGATGCGAAAATTACCGTCCTTCATCAAGGGTGCTATCATGTTTGCTCGATACTCAATCATAATGGCCGACATGCC
ATACACTACCCCTTTATACCGCTTACTCGTGACCGTATTCTGGAACTGGTCCCACTTGCGAATCGATTTCACTTATGTTGCTTTATGTGTCAACA
GCATAGTCTTATGTGGATTAGAGTTGGTAATTAAGGTGTGACCCAGCTAATATTTTGTACTTACACAAGTAGCATGTTCGTTTACGGTGGGTCTC
GTGTGTTGATTACCTATCTCTATAGTATTTTACTTATTATGCTACATCGTACAGGACAGCGAGAAAGCTGCACTCCCATGCGCATTGATTAGAAA
TATCAAACTTCTATAAGAGACGGTTGTTCTATAACCCTTACATCTATACCAACTTCCACCCCCGTCGTTCGCTGAGCGCATGCAACAAATACGTC
ATCCGCTAATTACCCAAGATATACCCTTATTACGCTCTACCGCTTCTTGTATGCCACACAAATCGATAACATGACTAGAGAACTCTCACGAGCTA
ATTGACGTGCCGTGCTCATAATATCGCATGATATCTTAGTAAAACGACCTACGAGTACATGCGTATGCTTTACATCCCTACCTTTATTCCAGCAT
GTTAGTCTGGTCGGAGTATTTTGTATAAGATATATTATACTTGCAGCCTCGACTACTTGTGGAGGTTATATAAGGAGCCGCGGATGATATCGATG
GTTCGGCATATTAACGCGCGGGAATCTACGGGCGTTGATCTCTGCACCTTACATCTATTAGGTCATGCTTCGGCTCTTTCACTGCAAATATTACC
ATCTTATGTATTTGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T345453 [Download][View] Facility Assigned ID: TUS66P18_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Problems: High expected error (low overall quality)
Sequence Entropy: 0.000 Expected Error Rate: 0.0832 Quality Trim Threshold: 20.5