EST details — SGN-E544579

Search information 
Request: 544579Match: SGN-E544579
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192965Clone name: TUS-66-P19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C96620 [cLEY-16-M8] Trace: SGN-T119964 EST: SGN-E307610 Direction: 5' Facility: TIGR
Clone: SGN-C192965 [TUS-66-P19] Trace: SGN-T345455 EST: SGN-E544580 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E544579Length: 513 bp (902 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E544579 [] (trimmed) AAGGCTAAAAGTAATTATGTCCTACAAACCCAATTCCAAATTTTCTTCAAGTCTTTACATATTGGGGGCAAATGTTAGAAAACGAAGCTAAACAA
AATGAAAATAATGGTCTAAAAAATAAAAAGCCCAAAACTAGGAAAGGGGGGAATTTAATTCCCCAATAGAATTTAAACCCCAATTAAAAAAAAAA
GGGGCAAAACAGAGCACCCCCCTAAAAAATTTAAAATACCTGTAATCTGAAAAGTATGATTTTGGGTTTCTTCAAAAATCAGGCATAAAAAGACT
GATTTTTCCTTCTTCAGCATCCAATTTTTGCTCAGAAACCCTCAACCCTTTGCAAACCGCAGTAAAACTTAGCCCCAAACTCAAGAATCCCCTTC
CTAGGCCGATCCCTACAATTGCCAAAACTGATAGCCCATTACTCTTTTTGGGGGGCAATGGGTCCCCGTAAAAATCCTTTTTCCCATCAAACGAA
CTGGCATTGAATCGGGGCAAGTTTCCCCTCCGGTTACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E544579] SGN-U574639 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T345454 [Download][View] Facility Assigned ID: TUS66P19_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.906 Expected Error Rate: 0.0167 Quality Trim Threshold: 14.5