EST details — SGN-E544613

Search information 
Request: 544613Match: SGN-E544613
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192985Clone name: TUS-67-A15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C96685 [cLEY-17-B12] Trace: SGN-T120289 EST: SGN-E306005 Direction: 5' Facility: TIGR
Clone: SGN-C192985 [TUS-67-A15] Trace: SGN-T345489 EST: SGN-E544614 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E544613Length: 795 bp (891 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E544613 [] (trimmed) TCAAAGAGAAGACTTCTTCACTTAATTTATTTGGTAGAAAAACAAGAAGGAAAAACCTATCAAGTTAGGTCAACAACCCAAAGATATTACATAAG
AGTAACTTCCCTTCTTTCTAGTACTTAGCAAATATCTAGCCTACTAACCAACATTTACTTATTTTTTTTCTTCTACCACTAACTTATAACCACAA
TCTATGAACATGATCAAGAAAAAAAATTGAAAAACTTTAGAAAATTACAGTCGTAATCGTAAGATTTAATTTAGACAAATAAAAACTTGATCTTT
ATTTATACATACAGGTTGATTGATTGCAGTTTCCTTGTGTTGTTTTTAGTGTTGTTGCTGCTCAATGTCTGGTGAAAACTCCCCATAGTTTGCCT
CTACTAAGACAATCCAAGAGCTTTTTAGCTCCTTCAATCTCCATCTCAGCTAGCTTCTGTAAATGCACACAAGCCCCGGAAGCCACCATTTGTTT
CCGGCAATTCTTGGAGTAAACAAGCGAAGCCAATAACGAAACAGGGTGTCTTTTGTCTAAGTTTTGTACCACAGGATCTAATAGCTGAACTGCAT
TCACAATACCCCTTTCTTCCTTCCTGAAAATCTTTCGATTTCCAGCGTAAATCATCAAAATTGACAATGCACTTGCAGCTGCTTCTTTCTCTTCC
ACGGATTTACCTTCTGTGAGTCTCACCAATGGCGGAATACACCCGATTTCGCCTAATTCTTTTCGGGTTCTTGTGTTGTATCCCAACTCATAAAT
TGCTTTTGCTGCAGCAATCCTAACACCTAAAACCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E544613] SGN-U565278 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T345488 [Download][View] Facility Assigned ID: TUS67A15_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0059 Quality Trim Threshold: 20.5