Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E544852

Search information 
Request: 544852Match: SGN-E544852
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193124Clone name: TUS-67-G10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C97423 [cLEY-21-I13] Trace: SGN-T120754 EST: SGN-E308455 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E544852Length: 655 bp (870 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E544852 [] (trimmed) AAACCAAGGTGATAATAAACATAGATAACTGGCAACCTGNGAGAGTTGTAGTTAATACATACCTAAAATCTATAGTAGACAACACTCTAATAGCT
TCACATTTCAAAAAGTGGAATACTGCTCCCTCTTCGATCTTCGCGAGGTGGTTCCATTGCAAGAAAAATATTATTCACTGTCCGAACTTCAAGAT
TAAATTCACCATATCCTCTCACACTTCATCTTATGCTTGCTGATCGAAATTCCCAAGCATTGGCAGTGAATCAAATTGTTTTCATCCTTGTGTGG
CAACATCTTGAATTTGACTTCTACAGGTACTCGAGCGGCTATCATTTGGAAGCAGCCGAATAGGTGATACCATTATTGCTCAAAGTAGAATACTC
ATGTTTTGGTATTACACAACTTACCTTCTCCTGGAGAAAAATAAGCCCAAGTATCAACGGCTTGAACCTCCACTGCGTCTCAAAGATATCGAAGA
AGAGCCAGAGGAAGAAGCAAAGCTTCAGCCCGTAAAGGATGATGATTTGCCTGAACCAACTCAACAAGTTGAATCTCCTCCCTCAGATGAAGGTA
AACCCGACGAGCAGCAGGAATCTTCTCCTGCTGATCCACTTGATCTGTTTACCCTTGACGGCTTGTAAATTGCTTGGGAAAAATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E544852] SGN-U588817 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T345727 [Download][View] Facility Assigned ID: TUS67G10_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0036 Quality Trim Threshold: 12.5