EST details — SGN-E544913

Search information 
Request: 544913Match: SGN-E544913
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193159Clone name: TUS-67-H21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C97632 [cLEY-22-I1] Trace: SGN-T120949 EST: SGN-E309244 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E544913Length: 220 bp (893 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E544913 [] (trimmed) GCTAACACAAAGTAGAGGAATCTATAAATGTGAAACAAGATGAAAAAGAATAGCTTCATAGACTTACTATTTATGTTACTAAAAGTTTTACTTAT
TTAACCTTTTAAGTCATATACTAGATGGGCTATGGCCTACAGCGCACGGGCCCAATATATTTAATTTTGGTAAAATTATATAATTAGATTTACAA
TAGTTTCAATTTACTACGTATTTTATAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E544913] SGN-U562950 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T345788 [Download][View] Facility Assigned ID: TUS67H21_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.897 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5