EST details — SGN-E54500

Search information 
Request: 54500Match: SGN-E54500
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70727Clone name: cLER-15-L18
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178801 is on microarray TOM1: SGN-S1-1-2.2.3.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C70727 [cLER-15-L18] Trace: SGN-T95432 EST: SGN-E282912 Direction: 5' Facility: TIGR
Clone: SGN-C178801 [TUS-30-B15] Trace: SGN-T184649 EST: SGN-E372209 Direction: 3' Facility: INRA
Clone: SGN-C178801 [TUS-30-B15] Trace: SGN-T184650 EST: SGN-E372210 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E54500Length: 568 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E54500 [] (called/trimmed by facility)
TTAGTAAATGTAACAAACGTATCGCAAGACCCACAAGAATTCAATACAAACACCATATCTGCAGTTTTTAGCTTTTCTTGAGGTTTTTTTTCATG
TTCGATGGCCTCAAGTGCTTCAAGATTCATCAAATGTGTCACGGTTGGTGATGGGGCTGTTGGCAAGACTTGTATGCTTATTTGCTATACCAGTA
ACAAGTTTCCCACTGACTATGTTCCGACGGTGTTTGACAACTTCAGCGCCAATGTGGTTGTTGAAGGGACCACAGTAAATTTAGGTCTTTGGGAT
ACTGCAGGACAAGAAGATTATAACAGATTAAGGCCACTGAGCTACCGAGGAGCAGATGTTTTTGTCCTAGCGTTCTCCTTGGTGAGTCGTGCAAG
CTATGAAAACATACTTAAGAAGTGGATTCCCGAACTTCAGCATTATGCTCCTGGAATTCCGGTGGTATTAGCTGGCACCAAACTTGATCTTCGTG
AGGATAAGCACTTCTTGGCTGATCATCCTGGATTAGTTCCTGTCACCACTGCGCAGGGAGAGGAGCTGCNGAAACAAATTGGTGCTGCCTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T95432 [Download] [View] Facility Assigned ID: TPRCH69THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence